RegulonDB RegulonDB 10.9: Gene Sequence
yfjF gene sequence


Size: 291        A: 82  T: 61  G: 84  C: 64

Fasta

 

>yfjF E. coli K12. Version NC_000913.3 GI:556503834
gtgccaggtaaaattgccgttgaggtggcttatgcgctacctgagaagcagtacctgcag
cgagtgacgctgcaggagggcgcgacggttgaagaagctattcgcgccagtggcttgctg
gaattgcgtaccgatatcgatttaactaaaaacaaagtcggcatttacagccgtccggca
aaactaagcgatagtgtgcatgatggcgatcgggtggagatttatcgccctctcattgcc
gatccgaaagagcttcgcaggcaacgagcagaaaaatcagcgaataaataa
              
                            

Download fasta file
RegulonDB