RegulonDB RegulonDB 10.9: Gene Sequence
ratA gene sequence


Size: 477        A: 111  T: 141  G: 132  C: 93

Fasta

 

>ratA E. coli K12. Version NC_000913.3 GI:556503834
atgatattatttgttggatttttgttgatggaaattgttatgcctcagattagccggacc
gcactggtaccctacagcgcggagcaaatgtatcagttagtgaatgacgttcagtcttat
cctcagtttttgccgggttgtaccggaagtcggattctggagtccactcctgggcagatg
actgcggcggtagatgtctctaaggctgggatcagcaaaacgtttactacccgcaaccag
ttgaccagtaaccaaagtattcttatgaatctggtggatgggccgttcaagaaattgatt
ggtggatggaagtttacgccgctgagccaggaggcgtgtcgtatcgagtttcatctcgac
tttgagtttaccaataagttgattgaactcgcctttggtcgcgtgtttaaagagctggcg
gctaatatggtccaggcttttacggttcgtgcgaaagaggtttacagtgccaggtaa
              
                            

Download fasta file
RegulonDB