RegulonDB RegulonDB 10.8: Gene Sequence
yfjI gene sequence


Size: 1410        A: 462  T: 413  G: 288  C: 247

Fasta

 

>yfjI E. coli K12. Version NC_000913.3 GI:556503834
atgttcaatggtcgtcctttccctgtagatgcatttcctaaaattatcaggaatgcaatt
tatgaagtggaacagcatacgcaggcccctcaaggtttgattgctgcttctgctcttggg
gtaatttctcttgcctgtcagaaccggattgatgtttgccgattgaataatctacgtggc
ccggtatcacttttcttaatgactctggctgaatcaggtgaacgtaagagtacggttgat
aaactgctgatgaagccattatatcaactggaagaggatttatttgaaaaatacacccac
gatcttaccgcatggagaaatgatgaagcaatttttaatattgaaaaaaaagcactgatg
tcaaaacttaaatcagatattcgacgtaacaaagatcacttggcaacaaatgaaagactt
aaagaactacttacgacaaacccgaaagctccagtgagattcaaatttttatttaacgat
gccacacctgcagctattaaagctcatctctgtgggcactggcgatcagtcggcatcatg
tctgatgaagctgggatcatttttaatggttacacacttaacgagctgccgtttatcaat
aagatgtgggatggttcaatatttacggtggaaaggaaaaacgagcccgagaaattaatt
agagatgcaagaataacactgtcgctgatggtccagcctaatgtttttaagggttatatc
gacaggaaaggagatatggcaaaggggattggattttttgcacggtgcctcatgtgccag
cctgcttcaacacaaggtaacagaaaaatttccaacccaattttttcaaatgaacatttg
ccggtatttcaccaacgtcttatggaaattgttaatgagagcatcattaaaattaatgaa
aataatcgcatctgcctccgattctctgcagaagcagaaagacattggatcgaattctac
aaccaggtcgagtcagaaatgagaatgattggccttctttatgattttaaggattatgct
tctaaaatggcggagaacatggcgaggcttgctgccttacttcattacttcagcggtgat
ggaggcgatatatctgttaccgcagtaaaagcagcagtggagatagtggcttggtatatt
gaagaatacatccgcttgttctctaaaaaagaagagttttctttagatgtttcagaagca
gatgagctttattgttggataaaagattactgcacgcaaaaattttcttcctgcatcaag
aaaaatattatcttacaatttgggccaaataaatttagaaatcgtgacaaggcaaatgaa
ttaattagaatcttaatttcacaaaacaaaatatttatatcttcatggggtaaaacaaaa
ataataaacataactcattgtgttttttga
              
                            

Download fasta file
RegulonDB