RegulonDB RegulonDB 10.8: Gene Sequence
abpB gene sequence


Size: 2190        A: 562  T: 557  G: 540  C: 531

Fasta

 

>abpB E. coli K12. Version NC_000913.3 GI:556503834
atgacagagatctatgaacaggcgaaacatagcctgcagggtgaggacttctcatcgttc
aattatctgtttgcggttaacaagctgttgtctaaccctgtttcgtatgacttgggacgg
gacttgatcgtgcgagctctcgattcgcgcgagcggttttccgagcacaccacaattttg
aaaaatatggtgagaaaatcaggtttgttcccgtatctcaaaaaggagttcaccagcctg
acaccggatgacctgagggtgcttgagctataccggacgccattctcggatggttatgtt
ttccactcaatgcagttccacatattcgatctgctcaagtctggtcaaaacgtggtgctg
agtgcacctacaagcatgggcaaaagtgcaatcgtcgattcattgctcggcatgggaact
ttgaaacggcttgttctggttgttccaaccgtggctcttgccgacgaaacccgtcgccga
ctgcaagagcgattcggtgaccgatatcagatcatccaccacagttcccaagtgtgccat
tccgatcaggctgtttatgtgttaactcaggagcgagtgaacgagcgtgacgacatcgtc
gacattgacctcttcgtcattgacgagttttacaagttggcgttccgacaactgaaaagc
ggggacattgatcatcaagacgaacgagtcatcgagctcaacattgcgttaagcaaactg
cttaaggtctccaggcagttttacctgacgggaccgttcgttaacagcattcgcggtctc
gaaaaacttggatatccgcatactttcgtttctaccgacttcaatacagtcgcgctagat
gttaagacgttcggcatcaaagcgaatgacgacaaagccaagctcaaagcgctgggggaa
atcgcgcacgcatgtgtcgacgcaacgatcatttattgcaagtcaccaactgttgcgggc
ctggtggcgcgcgagctgatcaggcttgggcatggcactccgactgagaatccccatgtc
gactgggtcagcgaagagttcgatgccgactgggattacacagtcgcccttagaaacggt
attggcttgcattttggcgcgctaccgagggcactgcagcaatacactgccgaccaattc
aatgctggaaaactgcgctttttgctctgcacctccacgatcattgaaggagtcaacact
atcgctaagaacgttgtgatctacgacaaccgcgatggaactcgcagcattgacaaattc
acccatgggaacatcaaaggtcgcgccgggcgcatgggcgttcacttcgtcggcaaaatc
ttttgcctggaggaaatcccggaagacaatctcaatcaagaggtggatattccgctcggt
attcagggcattgataccccaatcaacctgttagccagcgttcaaccagaccacttgtcc
gagttttcacaggatcgctttgatgaggttttcataaacgaccgtgtttccatcgacctt
gtgaagaagcattcgtacttccgtgtcgagcagttcgaaatgctgcaaagcatgttcgag
atgatggacgataacgaattttcctcgttagtgtttcactggactcccgcgacaaacttc
ctcaagacctttgcaaagatcattgccagactggttccccatacgttcagtcgcaatggg
gtccctgttaagcctacggatgtcatgatcgcaaaacttgccggctatttaagtgctgaa
agttattcggaatatctgaaaaatcagatcgattatgcacgacagtggatttctgaaggg
gagaaacgtactctttccattgccctcaacaatgatttgaagctcataaccaataccttc
ggctataccctacctaaggtgctcagcttgatggaggatgtagttaaacaccacgctgta
aagcgtggtatacgcagcaaagtcgattacacacatgtcaaattggcgttcgaaagtttc
catctaccaccaggtgtcaatgccttagaagagattggcattcccattcagacgttacac
cgactggtagacttgctggaattttccgacgaggctgatgtggatgagttgagccagtat
cttcgggatactcaggacatttggagtagatcgattgggtacgttgatcagatgtttatc
aggcgcgcgctcggtattagacgacattga
              
                            

Download fasta file
RegulonDB