RegulonDB RegulonDB 10.9: Gene Sequence
abpA gene sequence


Size: 1617        A: 444  T: 386  G: 387  C: 400

Fasta

 

>abpA E. coli K12. Version NC_000913.3 GI:556503834
atggagtcgaacgattcaggcggagtagccgccaagcacggtttcttatttcaggactgc
gtagccgcttaccatgtcacccgaatgcttcgtgacaagactatccgcagtgtgcgctgc
gaggtcacagacgatatcgacattgtatctgatggatacatcgacttcgttcaggtaaaa
agcaccggcaaaacacgttggaacatttcggacatcgttcagaattcaaaaggtgctgat
aaaaagacgatcccctgcagttcaattttgcacaaatcaatgcagtgtgagtctgacctg
tcccttggacgtaggtactccatcgtcacagaggaaaaggtcaacaaaacccttgagtac
ttgacgatcagcccaaacgcccgactagataagccaggtcgacaggaactcatcgatgac
ctcaacaaacgcacagacaattttttaacagactcaggtataagcgtttcagattggatc
gatgcggctacatgggaagtgttttcatccctgcgcgaactggaacttctagggatcaag
aacatacggctggcctcccaagatctacatggggtcattctcagttccgaaaccgtcgcc
gaagacatttggtgccgcatccttgatactgtgacgcgcaagggcgagcattctcgacgc
attcacagtgctgatgacaagtcctacttacgaccagacctacttgagtggttcaagcag
cgtgtcgaagatgaccaatctcggtcaggccgcaaaatctacgtcaaacgggacttaccc
cacatccttacgccatttagagcgcctatggcttcggtctgcgctaagcgtaaaggccag
gttctacatcagcagtactcacttaagaaataccgctacaagcacatcgcggataacgtc
tgtcaatggttggatgaggtttttctccgaccaaaagaaatgtctgatattcataaactg
acattcattgaaaagcgagaacgactaaagaattccgtcttcaaatcgctccatgacgtc
agcgaatttttgggtcgagtgctgttgcacgcaacgatccggcagcaccacgaaagccag
cctattccttgcatgctatacgtggaaaaagcaggggccgaaaaaattcttgaaaacgtg
catatcgttcgccgcgatccagaaggtgatcagctttggattggcttcagcgagttggtg
actgatattaacattgccgtcagattgccggagatacgggatcagttgtacgaggacatt
tcggattgcatcgataccgcgcgcaaaaaaatcctcgacattaaagacgataactacctg
cttcgccacgacattgacgaaattcttgatggcagccaacctttcgatgctcacctcgat
cgtttcacgtttgttctgttcgtgggctacgactctaatctactaaccgagcctgaaacg
ccggggttcgaggatgacctggagaaagaaacagcggtgctgttcgaaaaattcgcggct
gacctcatcgaggattcgccgtttgcgaatctttgcatccacgtattcatttatccagcc
ccgagtcttgagcggttaacccaattagttgatgagaaggtgagagaggtcgtatga
              
                            

Download fasta file
RegulonDB