RegulonDB RegulonDB 10.8: Gene Sequence
yfjM gene sequence


Size: 264        A: 93  T: 51  G: 60  C: 60

Fasta

 

>yfjM E. coli K12. Version NC_000913.3 GI:556503834
atgggggatgatgtccatcgtttcggtaacctcttcctgatctcaccaagcagcaactcg
atacttagtaattattcgccagcagacaagaaaaaattctacgtcgaaacagaacgagca
gagagcccaaaacaagccatcatgatgagctataaggagtggggtccggatgggcaaggc
atcaacaatatagaaagccatgaacacgcgatgttgacattgctcaaagagcatcgagat
atgaccctaccaaccaggaaataa
              
                            

Download fasta file
RegulonDB