RegulonDB RegulonDB 10.8: Gene Sequence
yfjP gene sequence


Size: 864        A: 190  T: 207  G: 241  C: 226

Fasta

 

>yfjP E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaattttgaagttctgcagccactacagaactccctttccggtctaccgctatgg
gtatctgaacgtatattgcagcagataaatcagttaacccactacgagccagtgatcggc
atcatgggtaaaactggggcgggaaagagtagcctttgcaatgccctgtttgccggtgaa
gtatcgccggtcagcgatgtagcggcctgtacacgtgatcctttacgctttcgcctgcag
attggagaacactttatgaccatcgtggatctgcccggcgtgggcgaaagtggcgttcgc
gataccgagtatgctgcgctgtaccgcgaacaacttccccggctcgacctgattctgtgg
ctgattaaggctgatgatcgggcactggcgactgatgagcatttttaccgtcaggtgatt
ggcgaagcataccggcataagatgctgtttgttatcagccagtcagacaaagctgaaccc
accagcggtggaaatatcctttccacagagcagaaacaaaatatcagccgcaaaatctgc
ctgctgcatgagctattccagcccgtgcatccggtgtgtgccgtgtcggttcgcctgcag
tggggactaagggtgatggcagagcggatgattaagtgtctgccgcgtgaggccagcagc
ccggtagtagcgctactgcaacatccctttcgaacaacggtagcccgggagcaggcacgt
gacgatttcggtgaaaccgtaggtgccatactcgatacggtaagcacctttccccttatt
cccgccccggtgcggaccattattcaggccgtgcgttcctcggtggtgtcagtggcccgc
gctgtctgggatttcttcttctga
              
                            

Download fasta file
RegulonDB