RegulonDB RegulonDB 10.9: Gene Sequence
yfjQ gene sequence


Size: 822        A: 182  T: 183  G: 250  C: 207

Fasta

 

>yfjQ E. coli K12. Version NC_000913.3 GI:556503834
atgacccgtctggcttcgcgctttggcgctgcaaatcttattcgccgtgaccgtccgtta
acccgtgaagagttatttcgcgtggtgcccagcgtattcagtgaggataaacacgaatcc
cgcagtgaacgctacacgtatatacccacaatttccctgctggacagcctgcagcgggaa
ggcttccagccattctttgcctgtcagacacgggtacgtgacccccgtcgtcgtgagcat
actaagcatatgctgcgcctacgtcgggaggggcaaattaccggtaaacaggttccggaa
attatcctgcttaactctcacgatggcaccagttcgtaccagatgctgccgggcatgttc
agggcggtgtgccagaacggtctggtctgcggcgagtcgtttggcgaggtgcgggtgcca
cacaagggggatgtggtgagtcaggttattgagggggcgtatgaagtgctggggattttt
gagcgtgtggaagaaaagagggatgccatgcagtcgttgcttttaccgccacctgtgcag
caggcactggcaaaagcagcgcttacgtatcgctttggtgaggaccaccagccggttact
gaatcgcagatactctccccacgccgctggcaggatgagagcaatgacctttggaccacc
tatcagcggattcaagaaaacctgattaagggcggactcagtgggcgtaatgctaaaggc
ggacgaactcatactcgtgccgtgcgtggcattgacggggatgtgaagcttaaccgtgcg
ctgtgggtgatggcagaaacactgctcacgcaactgcagtag
              
                            

Download fasta file
RegulonDB