RegulonDB RegulonDB 10.10: Gene Sequence
ypjK gene sequence


Size: 237        A: 46  T: 65  G: 66  C: 60

Fasta

 

>ypjK E. coli K12. Version NC_000913.3 GI:556503834
gtgcccgttattgccattatcgccattgttatcatcgtcatcattctgaacaaaaccgga
gtgtccgacagcctcacggccctgacacttgcaaccgttgccgcactactgacgggaggt
ggtgcagccggtgctgccagtgtcgcgctgacgccgttcgtcggcgtgccggtgggtatt
tttgtgggaatttatgtctttgccaaagtggttcgtctgatttcagggaaaaaataa
              
                            

Download fasta file
RegulonDB