RegulonDB RegulonDB 10.9: Gene Sequence
yfjT gene sequence


Size: 468        A: 123  T: 105  G: 121  C: 119

Fasta

 

>yfjT E. coli K12. Version NC_000913.3 GI:556503834
atgaaaatacgttcactaagccggtttgtactggcaagtacaatgttcgccagctttaca
gcctctgcggtccccggactctggcaacaggggtacggtcagggcaatgcggaatacagt
gtgacggatgccagcggaaagatgtttaccatcaactgcacgggaaatccggaccagaac
ggtatttaccagcactcggtttttctgatcctcgccggggataaaacggtcagctcgcat
gatgacagtaccggcatcacagtggtgatggaccataagcaatatgccattccctcaacc
cttggctggcgtaacggagataatgcctggttcagcttcatcatggatatccgtaaggcc
cggcagttcgacgtctacgtcaatgaccagaaagttggatcgtttaaccctgatgttcgg
aatgcacaaaaggtcctgccaacattagcggactgcactaacgactga
              
                            

Download fasta file
RegulonDB