RegulonDB RegulonDB 10.10: Gene Sequence
yfjU gene sequence


Size: 315        A: 93  T: 91  G: 59  C: 72

Fasta

 

>yfjU E. coli K12. Version NC_000913.3 GI:556503834
atgagcaacattaccatctatcacaacccggcctgtggcacctcacgcaacacgctggag
atgcttcataacaacggcaacgaaccgacaataattaattatctcgatatgccaccgacc
cgtgatgaactgattaaacttatttcagatatcttcagtgacaaaatcatcgagtgcatc
agggagcaatgtcacctgatgcctgccttgtccttgaatgtgattggccatgttgatatc
cgcagtattcattcatatctttttaattttaatgaaaaagttagtccgtctcatgggttt
atcaagaatggttga
              
                            

Download fasta file
RegulonDB