RegulonDB RegulonDB 10.9: Gene Sequence
yfjZ gene sequence


Size: 318        A: 74  T: 71  G: 81  C: 92

Fasta

 

>yfjZ E. coli K12. Version NC_000913.3 GI:556503834
atgagcaacaccacatggggcctgcagcgagatatcacgccgcgcctgggagcacgtctg
gtgcaggagggcaaccagctgcactatctggctgaccgggccagtatcaccggtaagttt
agtgacgccgaatgtcctaagctggatgtggtatttccacattttatcagccagatagag
tcgatgctgaccactggtgaactgaatccccgccatgcccaatgcgtcaccctgtaccac
aacggttttacctgcgaagccgatactcttggtagttgcggctacgtatacatcgctgtt
taccccactcaacgctaa
              
                            

Download fasta file
RegulonDB