RegulonDB RegulonDB 10.9: Gene Sequence
ypjF gene sequence


Size: 330        A: 91  T: 82  G: 77  C: 80

Fasta

 

>ypjF E. coli K12. Version NC_000913.3 GI:556503834
atgaacactctacctgctacaatttcgcaggcggcgaagccctgcctgtcgccagtggct
gtctggcaaatgctactgacacgcctgctggaacaacactatggcctgacactgaacgac
acgccgttcagtgatgaaactgttattaaggaacatatcgatgctggtatcactctggcc
gatgcagtcaattttctggtggaaaagtacgaactggtacgtatcgatcacagaggattt
tcgtggcaacaacagtctccatatatttccgtagtagatattctgcgagcaaggcgctct
accggcttgctaaaaactaatgtgaaataa
              
                            

Download fasta file
RegulonDB