RegulonDB RegulonDB 10.9: Gene Sequence
ypjA gene sequence


Size: 4581        A: 1334  T: 993  G: 1251  C: 1003

Fasta

 

>ypjA E. coli K12. Version NC_000913.3 GI:556503834
atgaacaggaccagtccctattattgtcgccgctcagtactttccttattgatatctgcc
ttgatatatgccccgcccgggatggctgccttcactactaatgttattggtgtggtaaac
gatgagactgtagatggcaaccaaaaagtggatgaacgaggtacaacaaataacactcat
attatcaaccatggccagcagaatgttcatggcggggtatctaatggaagtcttattgaa
tctggtggatatcaagatataggaagtcataacaattttgtggggcaggctaataataca
accattaacggtggcagacagtcaattcatgacgggggtatttccacaggtacgacaatc
gagagtggcaatcaggacgtttataaagggggtatcagcaatggaacgacaattaagggc
ggtgcttcacgcgtagagggagggagtgcgaatggaatactcattgatggtggtagccag
atagtaaaagttcaagggcatgctgatggtacaacgataaataagtctggctctcaggac
gtagtacaaggaagtctggcaacgaacacaaccataaatggtggtcgacagtatgttgaa
cagagcacagtagaaacaacaaccattaaaaatggcggtgagcaaagagtatatgagagc
cgtgcgctggacacgacgattgaaggcggaactcagtctctgaatagtaagtcaacggca
aaaaatacgcatatctattctggtggcacgcaaattgttgataacaccagcacctcggat
gttattgaagtttattctggtggcgtgcttgatgttaggggtggtacggcaacaaatgtt
acccagcacgatggtgcaattttaaaaactaacactaacggtacgacggtgagcggtacg
aatagtgaaggtgcattctccatccacaatcacgtggcagacaatgtgttgctggaaaac
ggtggtcatttagacataaacgcatatggttcggcaaacaagacgattattaaagataaa
ggaacaatgtcagttttaaccaatgctaaagctgatgcgacccgaatagataatggcggg
gttatggatgttgcaggaaacgcgacaaataccataattaatggtggcacacagaatatt
aataattatggcatagccacaggcaccaatatcaacagcggaacgcaaaatatcaaaagc
ggcgggaaagctgacacaacaattatatcctccgggagccggcaggttgttgagaaagat
ggtacggcaattggcagcaatattagcgccggaggctcgctgattgtctataccggcggt
attgcacatggggttaaccaggagacgggcagtgctttagttgccaacacgggtgcaggg
actgatatcgaaggatacaacaagctctctcacttcactattaccggaggggaggctaat
tatgttgtgctggaaaataccggcgaactgacggtagtggctaaaacctcggcgaaaaat
actaccattgatactggcggtaagctgattgtccagaaggaggctaaaacagatagcacc
agacttaataatggcggcgttctggaggttcaggacggtggtgaggctaagcatgttgag
caacaatccggcggcgcattaattgcttccacgacctccggaacacttatcgaaggaacc
aacagttatggtgatgctttctacatcaggaattcagaagctaaaaatgtagtgctggaa
aacgctggctcattaacagtcgtcactggttcccgcgcagttgacacgattattaatgcc
aacggcaaaatggatgtttatggaaaagatgttggcactgtactcaatagtgctggcacc
caaacaatatatgccagtgccacttctgataaagcaaatatcaaaggtggcaagcaaacg
gtatatggtttagccactgaagcaaatatcgaaagtggtgaacaaattgttgatggtggg
tcaacagagaaaacacacatcaatggtggcacgcaaaccgttcagaattatggtaaggca
atcaataccgatatcgtctctggcctacaacaaattatggcaaacgggacagcggaaggt
tccattattaatgggggttcacaggtagttaatgagggcggcctggctgaaaactcggtg
cttaatgacggcggcacactcgatgtgcgggagaaaggcagcgcaacggggatacagcag
agtagccagggcgctttggttgcaaccaccagggcgacgcgggtcacaggaacacgcgcg
gatggcgtcgcgttcagcatcgagcagggtgcggcgaacaatatcctgctggcaaatggc
ggcgtgttaaccgtggagtcagacacctcttctgacaaaacacaggtcaatatgggcgga
cgggagatcgtcaaaacaaaagccactgcgacaggcacgacgctcaccggcggtgaacaa
attgtcgagggtgtggcgaatgagacaacaattaacgacggcggaatacaaacagtttca
gctaacggagaggcaataaaaacaaagatcaatgaaggcggtacgctgacagtcaacgat
aatggcaaagcgacagatatcgtccagaacagcggtgccgctctccagacgagcacggct
aacggtattgaaatcagcggtactcaccagtacggtactttttccatttccggcaattta
gcgaccaatatgttgctggaaaatggcggtaatttattggtattagcaggtaccgaagct
cgcgactccacggttggcaagggtggggcaatgcaaaacctgggtcaggactccgccaca
aaggttaactctggcgggcaatatacccttgggcggtcaaaagatgagtttcaggctctg
gcccgggcagaagatctccaggtcgctggcggtacggcaatcgtctacgcaggtacgctg
gcggatgcatcggtcagtggcgcgacaggaagcctgtcgttaatgacgccacgggataat
gttacgccagttaaactcgaaggggcggtccggattaccgatagcgcgacattgactctg
ggaaatggcgtcgataccacgcttgccgacctgacggctgccagccggggcagtgtctgg
cttaacagcaataattcctgtgcaggtaccagcaactgcgaatatagagtaaacagtttg
ctactcaacgacggtgatgtttatttgtcagcacaaacagcagcgcctgccacaactaac
ggtatctacaatacgctgacaaccaatgaactttccggtagcggtaatttctacctgcat
accaacgttgcaggctcccggggcgatcaactggtcgtcaacaacaacgccactggtaat
tttaaaatctttgttcaggataccggcgtcagcccacagtctgacgacgcgatgacgctg
gtgaaaacagggggaggggatgcttcgtttacgctgggcaataccggcggtttcgttgat
cttgggacctatgagtatgtcctgaaaagtgacggcaacagcaactggaacctgaccaat
gatgtcaaacccaacccggaccccatcccaaatccaaagccagacccaaaacccgatcca
aagccagacccaaatccaaaaccagaccctactcccgatccaacgccgacacccgttccg
gagaaacgcattacgccttctacggcagccgtactcaatatggcagcaacattaccgttg
gtatttgatgctgagctaaacagtattcgcgagcggttgaacataatgaaagcgagtcca
cacaacaataatgtctggggggcgacgtataacacccgtaataatgtcaccaccgatgcg
ggtgccgggtttgagcagacgctgaccggaatgacagtggggatcgacagccgtaatgat
attcctgaaggaattaccacgctaggcgcttttatgggctattcccattcacatatcggt
tttgatcgcggaggacatggcagtgtgggcagttattctctgggcggctatgccagttgg
gaacatgaaagtggtttctatctggacggtgtcgtgaagctgaaccgttttaaaagtaac
gtagcaggtaaaatgagcagcggtggagccgccaatggcagttaccacagcaacgggctg
ggcggtcacattgaaaccgggatgcgatttaccgatggtaactggaacctgacgccgtat
gcatcgttaacggggttcaccgctgataaccccgaatatcatttatccaatggcatgaaa
tcgaaatcagtcgatacccgcagtatatatcgtgaactgggcgcaacgctgagttacaac
atgcgtctggggaacggtatggaagttgagccgtggctgaaggcggctgtgcgcaaagaa
tttgtcgatgataaccgggtgaaagtgaatagtgacggtaatttcgtcaattatttgtcg
ggcagacgtggaatataccaggcaggtattaaagcctcattcagcagtacgttaagcggg
catcttggggtggggtatagccatagtgccggtgtggaatccccgtggaacgcggtagct
ggtgtgaactggtcgttctga
              
                            

Download fasta file
RegulonDB