RegulonDB RegulonDB 10.10: Gene Sequence
ypjB gene sequence


Size: 792        A: 258  T: 256  G: 159  C: 119

Fasta

 

>ypjB E. coli K12. Version NC_000913.3 GI:556503834
atggaatcacgtaattcatatgaaaacaaaatagatgagatttcatctttgtcagagtca
aaggaacaccccatagatattcaagaaaaaaaagatgcgtttgtgaatgagttcaagggg
gtattatttgataaaaatacaaggtcttcagagcttctgtttaatttttatgagtgttgc
tataagtttttaccaagagctcagcctcaagataaaatcgatagctataattcagcactg
caagctttttccattttttgttcatctacgttgacacataataatataggctttgatttc
aaattatttcctgaagtcaagctgtctggagaacatcttgaaacggtattcaaatacaaa
aatggcgatgatgtccgggagatagccaaaattaacattactctccaaaaagaagagggt
ggtttatataatttacgtggattggattttaaggggtgcttcttttctggacagaacttc
agtaactatgatattcaatatgtgaactggggaacgtcattgtttgatgttgatactccg
tgtatttttaatgcgcctgcttacaacaagagtaatgaaaaatcattaaaacctgtgagc
gaaaacggtttaagtggagtattgactgatcgtaataataaaataaaactcatcacgggc
gtggcaccattcgatgatattttatttatggatgatgactttgatgatagttcctctgag
gatgatcccgttgagaatagtcctgttgtgactagtcccgttgtatcaagttctaaaagc
agttttcaatga
              
                            

Download fasta file
RegulonDB