RegulonDB RegulonDB 10.9: Gene Sequence
ygaQ gene sequence


Size: 2253        A: 800  T: 614  G: 405  C: 434

Fasta

 

>ygaQ E. coli K12. Version NC_000913.3 GI:556503834
atgttttctataaaaccaggacccagaaatttacctatcgacaaccccacattgttatca
tggaacattactgacggggatctaaattccaaattaaatacattagaatatctaaactgt
ataacaaatattattaattcttgtggagtttaccctcaaggattaaaagacagagaaatt
atatcaacttttcacgcagaaaaagttattaatgatctgttaaaaaacgattataaaatt
tccctttctccagatacaacttaccgagagttgaataaagcagcacagcgtagcattaca
gcgccagacaggataggagaaagaaaaacataggtttatcaacgagatacaatgattgaa
agaggtgataacagcggtgtttatcagtatggtcgtgctgaacatttcacccacattata
tctgacaaaccttccccaaaagataaatatgttgcatatgctattaacattcctgactat
gagctggcagccgatgtatataatattaacgtgacgtcaccttccggacagcaagaaaca
tttaaaatattaatcaatctagaacatctacggcaaacacttgaacgtaaatctcttact
gctgttcagaaatcacaatgtgaaatcatcacccccaaaaaacctggcgaagcgattctt
catgcttttaatgccacctaccagcagatcagagaaaatatgtctgaatttgcacgttgc
cattatgggtatatacaaatccctccagtgacaactttccgcgccgacggaccagaaact
cccgaagaagaaaagggttactggtttcatgcttatcaacccgaagatctttgtaccatc
cataatccaatgggagatttgcaggattttattgcattggttaaagatgctaaaaaattt
ggtatcgatatcattcctgattatacctttaactttatgggaattgggggtagtggtaaa
aatgacctggattatccctctgctgatatacgagcgaagatcagtaaagatatagaaggt
ggtatccctggctattagcaaggtcaggttttgattccattcattaaagatccagtaaca
aaagaacgtaaacaaatccatccagaagatatacatctcactgcaaaagacttcgaagca
agtaaagataacatctctaaggatgaatgggaaaacctccatgcattaaaagaaaagcgt
ttaaatggaatgcctaaaacaacacccaaaagtgaccaggttattatgttgcaaaatcaa
tacgttcgtgaaatgcgaaaatatggcgtacgaggtttacgttatgatgcggcaaaacac
tcaaaacatgaacaaatagaaagatcaataaccccaccgcttaaaaattataatgagcgg
ttacacaatactaacttatttaacccaaaatatcataaaaaagccgttatgaattacatg
gaatatctggtaacttgtcagttggatgaacaacaaatgtcatcactgctttatgaaaga
gatgatttaagcgccattgatttttcattgctcatgaaaacgataaaagccttttcattt
ggtggagatcttcaaacccttgcatcaaaaccgggttccacaatctcaagtatcccatca
gaaagacggatattgattaacattaaccacgattttcctaacaatggtaatcttttcaat
gactttctatttaaccatcaacaagatgaacaattagcaatggcatatatagccgctctg
ccgttcagcaggcctttagtttactgggatggccaagtattaaaatcaacgactgaaatt
aaaaattatgatgggtccacgcgtgtcggcggtgaggcgtagcttaataaaggttgctct
acctatcagcagctctacaatgaattccacgcattatatatagataaagcaggaatatgg
agcgcatttgagggtgtatctgcaactaaaaacgttctggcctttagtcgtggggattct
gtgaacattaatcactctcctcatgatggactagttataataaataaaggaaacgaagaa
gttgaaggtacctggcctaacaaattgcaacctggaatatacaaaaacatggggagtaat
agcgttaacattattattaataatacccgaaaaattatcccccctggtaaagtatttacg
cttagaggcggaactctaaatatcaatattcctgggcgtagcgctcttcttttagggaaa
acaggagaaccgccgaactatctctatttataa
              
                            

Download fasta file
RegulonDB