RegulonDB RegulonDB 10.9: Gene Sequence
glaH gene sequence


Size: 978        A: 225  T: 222  G: 265  C: 266

Fasta

 

>glaH E. coli K12. Version NC_000913.3 GI:556503834
atgaatgcactgaccgccgtacaaaataacgctgtcgattcaggccaggactatagcgga
ttcaccctcaccccgtcggcgcaatccccgcgtctgctggaactcaccttcaccgaacag
acgaccaaacagtttcttgagcaggttgccgagtggcccgtgcaggcgctggagtacaaa
tcgtttctgcgttttcgggtagccaaaattcttgacgatctatgtgcgaaccagctgcaa
ccattgctgttgaagacgttgctaaaccgcgctgaaggtgcgttgttgatcaatgcggtg
ggtgtcgatgatgtgaagcaagcggatgagatggtgaagctggcgacggcggtggcgcat
ctgattggccgttccaatttcgatgcgatgagcggtcagtattacgcgcgttttgtagtg
aaaaatgtcgataactcagacagctatctgcgccagccgcaccgcgtgatggagctacac
aacgacggcacgtatgtcgaagagataaccgattacgtgctgatgatgaaaatcgacgag
caaaacatgcagggcggaaattcgctgctgctgcatctcgatgactgggaacatctcgac
aactatttccgccacccgctggcgcgtcgcccgatgcgctttgccgcgccgccgagtaaa
aacgtcagcaaagatgtttttcatccggtgttcgacgtcgatcaacagggtcgcccggtg
atgcgctatatcgaccagttcgtccagccgaaagacttcgaagaaggcgtgtggttgagc
gagctttccgacgccattgaaaccagcaaaggcattctttctgtgcccgttcccgttggc
aaattcctgttgattaacaacctgttctggctgcacggtcgcgaccgctttactccgcac
ccggatctgcgccgtgaactgatgcgccagcgtggctatttcgcttacgcctctaaccac
taccagacgcatcagtaa
              
                            

Download fasta file
RegulonDB