RegulonDB RegulonDB 10.8: Gene Sequence
ygaY gene sequence


Size: 1178        A: 207  T: 330  G: 325  C: 316

Fasta

 

>ygaY E. coli K12. Version NC_000913.3 GI:556503834
atgactaaacctaatcatgagcttagcccggcgctgatcgtgctgatgtctatcgccacc
ggtctggcggtagccagtaactattacgcccagccattgctcgacaccatcgcgcgtaac
ttttccctttccgccagttcggcaggctttattgttaccgccgcgcagttgggctatgcc
gcaggtctactgtttcttgttcccctcggtgatatgtttgaacgccgccgcctgattgtc
tcgatgaccttactggcggcatgttgattaccgccagcagtcagtcgctggcgatgatga
tcctcggtacggcattaaccggtttattctcagtcgtggcacaaattctggttccgctgg
cagcgacgctggcttcaccggataaacgcggcaaagtggttggcactattatgagcggtc
tgctgttggggatcttgctggcacggacagttgccggattgctggcgaatctcggcggct
ggcgcaccgtcttttgggttgcttcggtgttaatggcactgatggcgctggcattatggc
gtggtctgccacaaatgaaatcagaaacccacctcaactacccacagttgttgggttccg
ttttcagtatgtttatcagcgataaaattctgcgtacccgcgcgttgctgggctgcctga
cctttgccaatttcagcattctctggacctcaatggcctttttgcttgccgctccacctt
ttaactacagcgatggtgtcattggtctgtttggacttgcgggagctgccggagcgttgg
gcgctcgtccggcgggcggttttgccgataagggcaaatcgcaccacaccacaactttcg
gtctgctgctgctattactttcatggctggcgatctggtttggtcacacttccgtactgg
cgttgattatcggaatcctggtgctggatctcaccgtgcagggcgtgcatatcactaacc
agacggtaatttatcggatacatcctgatgcgcgcaatcgcctgaccgcaggttacatga
ctagctactttattggcggtgccgccggttcgctaatttcagcctcagcctggcaacatg
gcggttgggctggcgtttgtctggctggcgcgacgattgccctggttaacttactggtct
ggtggcgaggttttcatcgtcaggaagccgcaaattaa
              
                            

Download fasta file
RegulonDB