RegulonDB RegulonDB 10.8: Gene Sequence
ygaH gene sequence


Size: 336        A: 62  T: 91  G: 93  C: 90

Fasta

 

>ygaH E. coli K12. Version NC_000913.3 GI:556503834
atgagctatgaggttctgctgcttgggttactagttggcgtggcgaattattgcttccgc
tatttgccgctgcgcctgcgtgtgggtaatgcccgcccaaccaaacgtggcgcggtaggt
attttgctcgacaccattggcatcgcctcgatatgcgctctgctggttgtctctaccgca
ccagaagtgatgcacgatacacgccgtttcgtgcccacgctggtcggcttcgcggtactg
ggtgccagtttctataaaacacgcagcattatcatcccaacactgcttagtgcgctggcc
tatgggctcgcctggaaagtgatggcgattatataa
              
                            

Download fasta file
RegulonDB