RegulonDB RegulonDB 10.9: Gene Sequence
yqaA gene sequence


Size: 429        A: 85  T: 132  G: 121  C: 91

Fasta

 

>yqaA E. coli K12. Version NC_000913.3 GI:556503834
gtgagtgaagcgttatcgcttttctcgttgtttgccagtagttttctcagcgctacacta
ttacccggcaactccgaagtcgtgctggtggcaatgttgctttccgggatcagtcatccc
tgggttttagttttaacagcaacaatgggtaatagccttggagggttaactaacgttatc
cttgggcgtttctttccattgcgtaaaacatcgcgctggcaagagaaagctaccggctgg
ctgaaacgctatggtgcagtcacgctattattaagctggatgcccgtggttggcgattta
ctgtgtctgttagcgggatggatgcgcatctcgtggggaccggtaatcttttttttgtgc
cttggtaaagcgttacgctatgttgcagttgcagcagcgaccgttcagggcatgatgtgg
tggcactaa
              
                            

Download fasta file
RegulonDB