RegulonDB RegulonDB 10.9: Gene Sequence
yqaB gene sequence


Size: 567        A: 126  T: 138  G: 169  C: 134

Fasta

 

>yqaB E. coli K12. Version NC_000913.3 GI:556503834
atgtacgagcgttatgcaggtttaatttttgatatggatggcacaatcctggatacggag
cctacgcaccgtaaagcgtggcgcgaagtattagggcactacggtcttcagtacgatatt
caggcgatgattgcgcttaatggatcgcccacctggcgtattgctcaggcaattattgag
ctgaatcaggccgatctcgacccgcatgcgttagcgcgtgaaaaaacagaagcagtaaga
agtatgctgctggatagcgtcgaaccgcttcctcttgttgatgtggtgaaaagttggcat
ggtcgtcgcccaatggctgtaggaacggggagtgaaagcgccatcgctgaggcattgctg
gcgcacctgggattacgccattattttgacgccgtcgtcgctgccgatcacgtcaaacac
cataaacccgcgccagacacatttttgttgtgcgcgcagcgtatgggcgtgcaaccgacg
cagtgtgtggtctttgaagatgccgatttcggtattcaggcggcccgtgcagcaggcatg
gacgccgtggatgttcgcttgctgtga
              
                            

Download fasta file
RegulonDB