RegulonDB RegulonDB 10.9: Gene Sequence
pncC gene sequence


Size: 498        A: 109  T: 107  G: 163  C: 119

Fasta

 

>pncC E. coli K12. Version NC_000913.3 GI:556503834
atgactgacagtgaactgatgcagttaagtgaacaggttgggcaggcgctgaaagcccgt
ggcgcaaccgtaacaactgccgagtcttgtaccggtggttgggtagcgaaagtgattacc
gatattgccggtagctccgcctggtttgaacgcggatttgtcacctacagtaacgaagcc
aaagcgcagatgatcggcgtacgcgaagagacgctggcgcagcatggcgcggtgagtgaa
cccgtcgtggtggaaatggcgataggcgcactgaaagcggctcgtgctgattatgccgtg
tctattagtggtatcgccgggccggatggcggcagtgaagagaagcctgtcggcaccgtc
tggtttgcttttgccactgcccgcggtgaaggcattacccggcgggaatgcttcagcggc
gaccgtgatgcggtgcgtcgtcaggctactgcgtatgcattgcagaccttgtggcaacaa
tttctacaaaacacttga
              
                            

Download fasta file
RegulonDB