RegulonDB RegulonDB 10.9: Gene Sequence
mltB gene sequence


Size: 1086        A: 252  T: 235  G: 309  C: 290

Fasta

 

>mltB E. coli K12. Version NC_000913.3 GI:556503834
atgttcaagcgtcgttatgtaacattgcttcccctttttgtgttgcttgccgcctgtagc
agcaagccaaaacctactgagactgatacgaccaccggaacgccgtctggcggcttcctg
cttgagccgcagcacaatgtgatgcagatgggcggcgatttcgctaataacccgaatgcc
cagcagttcatcgacaaaatggtgaacaaacacggtttcgatcgtcagcagttgcaggaa
attctctcccaggcgaagcgtctggattcggtactgcggctgatggataaccaggcacca
accacatcggtgaaaccgccatcaggtccgaacggcgcatggctccgttatcgcaaaaaa
tttattacgccggacaacgtgcagaacggtgtggttttctggaatcagtatgaagatgcg
ttgaatcgcgcgtggcaggtgtatggagtaccgccggaaattatcgtcgggattatcggc
gttgaaacccgctgggggcgcgtgatggggaaaactcgcatcctcgatgcgctggcaacg
ctgtcatttaactacccacgccgcgcggagtatttctctggcgagctggaaaccttcctg
ttgatggcgcgcgacgagcaggacgatccgctcaatctgaaaggttcctttgccggggcg
atgggctacggacagtttatgccgtcgtcttacaaacaatatgcggtagatttcagcggc
gacgggcatatcaacctgtgggatccggttgatgcgatcggtagcgtggcgaactatttc
aaagcgcacggctgggtgaaaggcgatcaggtcgcggtaatggcaaacggtcaggctcca
ggcttgccaaatggcttcaaaactaagtacagcatttcgcagcttgccgccgcaggttta
acgccacagcagccgctgggcaaccatcaacaagccagcctgctgcgtctggatgttggc
accggctaccagtactggtacggtctgccgaacttctacaccatcacccgttacaaccac
agcacccattacgcaatggcggtctggcagttaggacaagccgtggcgctggcgcgagta
cagtag
              
                            

Download fasta file
RegulonDB