RegulonDB RegulonDB 10.9: Gene Sequence
ygbI gene sequence


Size: 768        A: 188  T: 184  G: 227  C: 169

Fasta

 

>ygbI E. coli K12. Version NC_000913.3 GI:556503834
ttgatacccgtagagcgtcgccaaatcatccttgagatggtagctgaaaaaggcattgtc
agtattgctgaactaacggacagaatgaatgtgtcacatatgaccattcgtcgggattta
caaaaactggagcagcagggagccgttgtgctggtgtccggaggcgtccagtctccggga
cgcgtggcgcatgaaccttctcatcaggtaaaaactgcgctggcaatgacgcaaaaagcg
gctattggcaagctggcggcaagtcttgttcagccgggaagttgtatctatctggatgcg
ggaacgaccacgttagcgatagcacagcatctgattcacatggagtcactgactgtggtc
acaaacgatttcgttattgcggactacttgctcgacaacagtaattgcacaattattcac
actggcggtgcagtgtgtcgggaaaaccgttcctgtgtcggggaagccgctgcgaccatg
ctgcgcagcctgatgattgatcaggcttttatttctgcatcgtcatggagtgtgcggggg
atttctacgccagcggaagataaagtcacggtgaaacgggcgattgccagtgccagccgc
cagcgagttttggtctgtgatgcgacgaaatatggtcaggtggcgacatggctggcgtta
ccattaagcgagtttgatcagattattacagacgacggtttgccggagagtgccagtcgc
gcgctggtgaagcaggatctctctttgctggtagcgaaaaatgaataa
              
                            

Download fasta file
RegulonDB