RegulonDB RegulonDB 10.9: Gene Sequence
ygbJ gene sequence


Size: 909        A: 208  T: 219  G: 266  C: 216

Fasta

 

>ygbJ E. coli K12. Version NC_000913.3 GI:556503834
atgaaaacgggatctgagtttcatgtcggtatcgttggcttagggtcaatgggaatggga
gcagcactgtcatatgtccgcgcaggtctttctacctggggcgcagacctgaacagcaat
gcctgcgctacgttgaaagaggcaggtgcttgcggggtttctgataacgccgcgacgttt
gccgaaaaactggacgcactgctggtgctggtggtcaatgcggcccaggttaaacaggtg
ctgtttggtgaaacaggcgttgcacaacatctgaaacccggtacggcagtaatggtttct
tccactatcgctagtgctgatgcgcaagaaattgctaccgctctggctggattcgatctg
gaaatgctggatgcgccagtttctggtggtgcagtaaaagccgctaacggtgaaatgact
gtcatggcctccggtagcgatattgcctttgaacgactggcacccgtgctggaagccgtt
gccggaaaagtttatcgcataggtgcagaaccgggactaggttcgaccgtaaaaattatt
caccagttgttagcgggcgtacatattgctgccggagccgaagcgatggcacttgcagcc
cgtgcggggatcccgctggatgtgatgtatgacgtcgtgaccaatgccgccggaaattcc
tggatgttcgaaaaccggatgcgtcatgtggtggatggcgattacaccccgcattcagcc
gtcgatatttttgttaaggatcttggtctggttgccgatacagccaaagccctgcacttc
ccgctgccattggcctcaacagcattgaatatgttcaccagcgccagtaacgcgggttac
gggaaagaagacgatagcgcagttatcaagattttctctggcatcactctaccgggagcg
aaatcatga
              
                            

Download fasta file
RegulonDB