RegulonDB RegulonDB 10.9: Gene Sequence
ygbK gene sequence


Size: 1167        A: 267  T: 257  G: 327  C: 316

Fasta

 

>ygbK E. coli K12. Version NC_000913.3 GI:556503834
atgatcaagattggcgttatcgccgatgattttaccggcgcgacggatatcgccagtttt
ctggtggaaaacggtctaccaacggtacaaattaacggtgttccaacaggtaaaatgccg
gaagcaatcgacgcactggtgatcagcctgaaaacgcgctcctgtccagtggttgaagcc
acacagcaatcgctggcggctctgagctggttgcaacagcaaggttgcaaacagatctat
ttcaaatactgctctactttcgacagtacggcgaaaggtaatattggcccggttaccgat
gccttaatggatgctctcgacacgccgtttacggtcttctctccggccctgccggtcaac
ggacgtacggtttatcaggggtatttgttcgtaatgaatcaactgctggccgaatccggg
atgcgccatcacccggtaaatcccatgaccgacagctatcttccccgtctggttgaagcg
caatccacagggcgctgcggcgtcgtttcggcacatgttttcgaacaaggtgtggatgcc
gttcgtcaagagctggctcgcttacagcaagagggctaccgctacgcggtgcttgatgcg
ctgaccgaacaccatctggaaattcagggagaagccttgcgcgatgccccactggtaacg
ggcggttctggtctggcgattggcctggcccggcagtgggcgcaagaaaacggtaaccag
gctcgcaaagcagggcgtccgctcgctgggcgcggcgtagtgctctccggttcatgctct
caaatgaccaaccgccaggtagcacattaccgtcaaattgcaccagcccgtgaagttgat
gtggcacgctgcctctcaattgaaactctggccgcttatgcacacgaactggcagagtgg
gttctgggccaggaaagtgtacttgctccactggtttttgccaccgccagcactgacgca
ttggcagcaattcaacagcaatacggtgcacaaaaagccagtcaggcagtagaaacactg
ttttctcaactagcggcgcggttagcagcggaaggcgtgacacgctttattgtcgcaggc
ggtgagacctccggcgtagtcacacagagcctgggaataaaagggtttcatattggccca
accatttccccggcgtgccgtgggtaa
              
                            

Download fasta file
RegulonDB