RegulonDB RegulonDB 10.9: Gene Sequence
ygbM gene sequence


Size: 777        A: 191  T: 186  G: 200  C: 200

Fasta

 

>ygbM E. coli K12. Version NC_000913.3 GI:556503834
atgcctcgttttgcagctaatttatccatgatgttcaccgaagtgccttttattgaacgc
ttcgccgcagcgcgaaaagccgggttcgatgctgtggaatttctgtttccctataactac
tccaccctgcaaatccaaaagcaactggagcaaaaccatctgacactggcgctgttcaat
accgctcccggagatattaatgcgggggaatggggattatccgcccttcccggacgtgag
cacgaagcacacgcagacatcgacctggcactggaatatgcattggcgctcaattgtgaa
caagtccatgtgatggcaggcgtcgtgcccgctggcgaagatgctgaacggtaccgggca
gtatttatcgataatatccgctacgctgccgaccgctttgcgccacacggcaagcgaata
ttagttgaagcactcagccccggcgttaagcctcattatctcttctccagccagtatcag
gcactggctattgttgaagaggttgcgcgagataacgtgtttattcaactagatactttt
catgcgcaaaaagtagatggcaacctgacgcatttaatccgcgactacgccgggaaatat
gcgcacgtacaaattgccggactacctgatcgacatgaaccggacgatggagaaatcaac
tatccgtggctgttccgcctgttcgatgaggtgggatatcagggctggatcggttgtgaa
tataaacctcgtggcctcaccgaagaagggcttggctggtttgacgcctggcgctaa
              
                            

Download fasta file
RegulonDB