RegulonDB RegulonDB 10.9: Gene Sequence
ygbN gene sequence


Size: 1365        A: 280  T: 379  G: 378  C: 328

Fasta

 

>ygbN E. coli K12. Version NC_000913.3 GI:556503834
atgtccacaattacattgttatgcattgcgttagctggcgtaatcatgctgttgctgctg
gtcatcaaggcaaaggtacaaccattcgttgctttgctcctcgtcagcctgttagtcgca
cttgcggcaggtataccggcgggcgaagtgggtaaagtgatgatcgccgggatgggcggt
gtgcttggttccgtcactattattattggtctgggcgctatgctggggcgtatgatcgaa
cactctggtggtgcagagtcactggctaattatttcagtcgcaagttaggtgacaaacga
actatcgctgcgctgactctggcagcgttcttcctcggtattcccgtcttctttgatgtc
ggctttattattcttgcgccaatcatttacggttttgccaaggttgccaaaatatcgcca
ctcaaatttggcctgcctgtcgctgggatcatgctcactgttcacgtggcggtaccgccg
catccaggccctgtcgccgcagcggggttactccacgcagacatcggctggctaaccatc
atcggtattgcgatttctattcccgtaggggttgttggctactttgcagcgaaaataatc
aataagcgccaatatgcgatgtcagtagaagtactggaacagatgcaactggctccggcc
agtgaggaaggcgcgacaaaattaagcgataaaataaatccaccgggcgtcgcgctggtc
acctcgctaattgttattcctatcgcgattatcatggcgggtacggtttccgcaacactg
atgccgccttcgcatcccctgcttggtacgctacagctgatcggctcaccaatggtagct
ctaatgattgcgctggtgctggcattctggttattggctttacgtcgcggctggagctta
caacacaccagcgacattatgggctcagcgcttcctactgcggcggtagtgattttggtt
actggtgctggaggggtatttggcaaagtgctggtggaatcgggcgtcggcaaagccctt
gccaacatgctacaaatgattgacctgcctctgttaccagccgcatttattatttcactg
gcgctgcgtgcatcgcaggggtcagcaaccgtagcaatactgacaaccggcgggttactc
tcagaagcggtgatgggattgaatccgattcagtgcgtattggtgacgctggcagcctgc
tttggtgggcttggtgcgtcacatattaatgactcagggttctggattgtgaccaaatat
ctggggttgtcggtagcagacggtctgaaaacctggacagtgttaacgaccattctcggt
tttaccggattcttaattacctggtgcgtatgggcggtaatttga
              
                            

Download fasta file
RegulonDB