RegulonDB RegulonDB 11.0: Gene Sequence
truD gene sequence


Size: 1050        A: 262  T: 240  G: 310  C: 238

Fasta

 

>truD E. coli K12. Version NC_000913.3 GI:556503834
atgattgagtttgataatctcacttacctccacggtaaaccgcaaggcaccgggctgctg
aaagccaatccggaagactttgtggtggtggaagatttgggctttgagcctgatggtgaa
ggtgagcatattctggttagaatcctcaaaaacggctgcaatacccgttttgtggcggat
gcactggcgaaattcctgaaaattcatgcccgtgaagtcagcttcgctgggcaaaaagac
aaacatgctgttacggaacagtggttatgcgctcgcgtgccgggcaaggaaatgcccgat
ctgagcgcctttcaactggaaggctgccaggtgctggagtatgcgcggcacaagcgcaag
ctgcgtttaggcgcgctgaaaggtaacgcctttaccctggttctgcgcgaagtgagcaat
cgcgatgacgttgaacaacgtctgatcgatatttgcgtaaaaggtgtaccgaactacttc
ggtgcccaacgttttgggattggcggtagcaacttgcagggggcgcagcgctgggcgcaa
accaatactccggtgcgcgatcgcaataaacggagtttttggttgtcggcagcccgcagt
gcgttgtttaatcagattgttgctgagcgcctcaaaaaagcagacgttaatcaagttgtt
gacggcgatgcgctacaattagccggacgtggtagctggtttgtcgcaaccaccgaagaa
ctggcggaattacagcgtcgcgtcaacgataaagagttgatgataaccgccgcattgcca
ggcagtggcgaatggggaactcagcgtgaagcgctggcattcgaacaagcagctgtcgcc
gcagaaactgaattacaagctttactggtgcgcgaaaaagttgaagccgcgcgcagagcg
atgctgctgtatccgcaacaattaagctggaattggtgggatgacgtcaccgtagagatc
cgtttctggcttccggcgggtagttttgcaaccagcgttgtcagggaacttatcaacaca
acaggtgattatgcgcatattgctgagtaa
              
                            

Download fasta file
RegulonDB