RegulonDB RegulonDB 10.8: Gene Sequence
ispD gene sequence


Size: 711        A: 154  T: 163  G: 197  C: 197

Fasta

 

>ispD E. coli K12. Version NC_000913.3 GI:556503834
atggcaaccactcatttggatgtttgcgccgtggttccggcggccggatttggccgtcga
atgcaaacggaatgtcctaagcaatatctctcaatcggtaatcaaaccattcttgaacac
tcggtgcatgcgctgctggcgcatccccgggtgaaacgtgtcgtcattgccataagtcct
ggcgatagccgttttgcacaacttcctctggcgaatcatccgcaaatcaccgttgtagat
ggcggtgatgagcgtgccgattccgtgctggcaggtctgaaagccgctggcgacgcgcag
tgggtattggtgcatgacgccgctcgtccttgtttgcatcaggatgacctcgcgcgattg
ttggcgttgagcgaaaccagccgcacgggggggatcctcgccgcaccagtgcgcgatact
atgaaacgtgccgaaccgggcaaaaatgccattgctcataccgttgatcgcaacggctta
tggcacgcgctgacgccgcaatttttccctcgtgagctgttacatgactgtctgacgcgc
gctctaaatgaaggcgcgactattaccgacgaagcctcggcgctggaatattgcggattc
catcctcagttggtcgaaggccgtgcggataacattaaagtcacgcgcccggaagatttg
gcactggccgagttttacctcacccgaaccatccatcaggagaatacataa
              
                            

Download fasta file
RegulonDB