RegulonDB RegulonDB 11.0: Gene Sequence
cas1 gene sequence


Size: 918        A: 210  T: 237  G: 253  C: 218

Fasta

 

>cas1 E. coli K12. Version NC_000913.3 GI:556503834
atgacctggcttccccttaatcccattccactcaaagatcgcgtctccatgatctttctg
caatatgggcagatcgatgtaatagatggcgcgtttgtacttatcgacaagacagggatc
cgcactcatattcctgttggctcggttgcctgcatcatgctggaacctggtacacgggtt
tcgcatgcagctgtacgcctggctgcgcaagttggaacattgttggtatgggtgggggaa
gcgggcgttcgtgtttatgcttctggtcagcctggaggtgcgcgttcagataagctgctc
tatcaggcaaaacttgctctggatgaagatttgcgtctgaaggtcgtacgtaaaatgttt
gaacttcggtttggagaacctgcgcctgcccggcgctccgtagagcaactcagaggtata
gaaggcagtcgcgtgcgggcaacctacgcacttctggcgaagcaatacggcgtgacatgg
aatggacgtcgctacgatccgaaagactgggaaaagggcgatacgatcaaccaatgcatt
agcgctgcaacttcctgtttatacggcgtaactgaagcggcgatacttgcagctggttat
gcaccagctattgggtttgtgcatacaggaaagcctctttcctttgtttacgatattgca
gacatcattaaatttgacactgttgtaccgaaagcttttgagatagcgcgtcgtaaccct
ggtgagccggaccgggaagtccgtttggcgtgcagggatatttttcgcagtagtaaaaca
ttagccaaattgattccgcttatagaggacgtgcttgccgctggagaaatacaaccgccg
gccccacctgaagatgcacagcctgttgccattccgcttcctgtttcactgggagatgca
ggccatcggagtagctga
              
                            

Download fasta file
RegulonDB