RegulonDB RegulonDB 10.9: Gene Sequence
casC gene sequence


Size: 1092        A: 310  T: 307  G: 259  C: 216

Fasta

 

>casC E. coli K12. Version NC_000913.3 GI:556503834
atgtctaactttatcaatattcatgttctgatctctcacagcccttcatgtctgaaccgc
gacgatatgaacatgcagaaagacgctattttcggcggcaaaagacgagtaagaatttca
agtcaaagccttaaacgtgcgatgcgtaaaagtggttattacgcacaaaatattggtgaa
tccagtctcagaaccattcatcttgcacaattacgtgatgttcttcggcaaaaacttggt
gaacgttttgaccaaaaaatcatcgataagacattagcgctgctctccggtaaatcagtt
gatgaagccgaaaagatttctgccgatgcggttactccctgggttgtgggagaaatagcc
tggttctgtgagcaggttgcaaaagcagaggctgataatctggatgataaaaagctgctc
aaagttcttaaggaagatattgccgccatacgtgtgaatttacagcagggtgttgatatt
gcgcttagtggaagaatggcaaccagcggcatgatgactgagttgggaaaagttgatggt
gcaatgtccattgcgcatgcgatcactactcatcaggttgattctgatattgactggttc
accgctgtagatgatttacaggaacaaggttctgcacatctgggaactcaggaattttca
tcgggtgttttttatcgttatgccaacattaacctcgctcaacttcaggaaaatttaggt
ggtgcctccagggagcaggctctggaaattgcaacccatgttgttcatatgctggcaaca
gaggtccctggagcaaaacagcgtacttatgccgcttttaaccctgcggatatggtaatg
gttaatttctccgatatgccactttctatggcaaatgcttttgaaaaagcggttaaagcg
aaagatggctttttgcaaccgtctatacaggcgtttaatcaatattgggatcgcgttgcc
aatggatatggtctgaacggagctgctgcgcaattcagcttatctgatgtagacccaatt
actgctcaagttaaacaaatgcctactttagaacagttaaaatcctgggttcgtaataat
ggcgaggcgtga
              
                            

Download fasta file
RegulonDB