RegulonDB RegulonDB 10.9: Gene Sequence
casB gene sequence


Size: 483        A: 139  T: 120  G: 121  C: 103

Fasta

 

>casB E. coli K12. Version NC_000913.3 GI:556503834
atggctgatgaaattgatgcaatggctttatatcgagcctggcaacaactggataatgga
tcatgtgcgcaaattagacgtgtttcagaacctgatgaattacgcgatatccctgcgttt
tataggctggtgcaaccttttggttgggaaaacccacgtcaccagcaggctcttttgcgc
atggtgttttgcctgagcgcaggaaagaatgtcatccgacatcaggacaaaaaatcggag
caaacaacaggtatctcgttgggaagagctttagccaatagtggaagaattaacgagcgc
cgtatctttcaattaattcgggctgacagaacagccgatatggtccagttacgtcgatta
cttactcacgccgaacccgtacttgactggccattaatggccaggatgttgacctggtgg
ggaaagcgcgaacgccagcaacttctggaagattttgtattgaccacaaacaaaaatgcg
taa
              
                            

Download fasta file
RegulonDB