RegulonDB RegulonDB 11.0: Gene Sequence
queD gene sequence


Size: 366        A: 96  T: 89  G: 91  C: 90

Fasta

 

>queD E. coli K12. Version NC_000913.3 GI:556503834
atgatgtccaccacgttatttaaagatttcaccttcgaagccgctcaccgcttaccacac
gtcccggaagggcataaatgtggtcgcctgcacgggcattcctttatggtgcgactggaa
attaccggggaagtcgatccgcatacgggctggattatcgatttcgctgaactaaaagcg
gcgtttaaaccaacctacgagcgcctcgatcaccattatctcaatgatattccaggtctg
gaaaacccaaccagcgaggttttagcaaaatggatttgggatcaggttaaacccgttgtg
ccgctgttaagtgcggtgatggtaaaagaaacctgcaccgcaggttgtatctatcgcggc
gaatga
              
                            

Download fasta file
RegulonDB