RegulonDB RegulonDB 10.9: Gene Sequence
ygcN gene sequence


Size: 1272        A: 260  T: 308  G: 372  C: 332

Fasta

 

>ygcN E. coli K12. Version NC_000913.3 GI:556503834
atggaagacgactgcgacattattattattggtgccggtattgcaggcaccgcttgcgcg
ttacgctgcgcgcgagcgggtttatccgttttgttactggaacgcgctgaaatccccggc
agcaaaaatctttccggcgggcggttatatacccatgcactcgcggaactcctcccgcaa
tttcatctgaccgcgcctcttgaacgacgcatcactcacgaaagcctttccctgttaacg
cccgatggcgtaacgacgttttccagcttacagcccggcggtgaatcctggagtgtatta
cgtgcacgattcgatccgtggctggttgccgaagccgaaaaagaaggtgtcgaatgcatc
cccggagcgacggtggatgcactgtatgaagaaaacggcagagtctgtggcgttatttgt
ggtgacgatattctccgcgcccgttatgtggtgctggcagaaggtgccaacagcgtcctg
gctgaacgtcacgggttagtgactcgtcctgctggcgaagcgatggcgttggggatcaaa
gaagtgctgtcgctggaaacatccgctattgaagaacgttttcatctggagaataacgaa
ggcgcagcgttgctgttcagcggcaggatctgtgatgacttacccggcggcgcatttctt
tatactaatcaacaaacgctctcgttagggattgtttgcccgctctcttcccttacgcaa
agtcgtgttccggcaagcgagctgctgactcgctttaaagcgcatccggcagtgcgcccg
cttatcaaaaacacggaatcactggagtatggtgcgcatctggtgccagaaggtggcttg
cacagtatgccggtgcaatacgccggtaacggctggctgctggtgggcgatgcgttgcgc
agttgcgtcaataccggaatttccgtgcgcggcatggatatggcgctgactggcgcgcag
gcggcggcacaaacgctgataagcgcctgccagcaccgcgagccgcaaaatctgtttccg
ctttatcatcacaacgtagagcgcagcctgctgtgggatgttctacagcgttatcagcat
gttccggcgcttttgcaacgcccgggatggtaccgtacgtggcctgcgttaatgcaggat
atttcccgcgatttatgggatcagggtgataaacctgttccaccgctgcgccagttattc
tggcatcatttacgtcgtcacggcctgtggcatctggcgggcgatgttatcaggagtctg
cgatgtctgtag
              
                            

Download fasta file
RegulonDB