RegulonDB RegulonDB 10.9: Gene Sequence
ygcQ gene sequence


Size: 861        A: 198  T: 184  G: 281  C: 198

Fasta

 

>ygcQ E. coli K12. Version NC_000913.3 GI:556503834
atgaatatcgcaattgtgacaataaatcaggagaatgccgcaatagcaagctggctggcg
gcgcaggatttcagcggttgtaccctggcgcactggcagattgaacctcagcctgtagtg
gcggaacaggtgctggatgcgttggtggaacagtggcagcgaacgcctgcggacgttgtt
ctctttccgccgggaacgtttggcgatgaactgtcgacccggctggcctggcgtttacat
ggtgcaagcatctgccaggtgacttcgttagatattccaaccgtaagcgtgcgcaaatcc
cactggggaaatgcgctaacggcgacgctgcaaacagaaaaacgcccgctatgcctttcc
ctggcgcgtcaggcgggagcagcgaaaaacgccacgttgccctctggaatgcaacaactg
aacattgtcccgggtgcgcttccggactggctggttagcacagaggatctgaaaaatgtt
acccgcgacccattagctgaggccagacgggtgctggtggtggggcagggcggagaggca
gataaccaggaaatcgctatgctggcagaaaagctgggagccgaagtgggctacagtcgg
gcgcgagtgatgaacggtggcgttgatgctgaaaaagtgattggtatttccggacatctg
ctggcacctgaggtgtgtattgttgttggcgcttctggcgcagcagcgttaatggcgggc
gtacgcaatagcaagtttgtggtggcgattaatcatgacgccagcgctgcggtattttca
caggcagatgttggcgtggttgatgactggaaagtggtgctggaggcactggtgacaaac
attcacgcagattgccaataa
              
                            

Download fasta file
RegulonDB