RegulonDB RegulonDB 10.9: Gene Sequence
queE gene sequence


Size: 672        A: 169  T: 156  G: 189  C: 158

Fasta

 

>queE E. coli K12. Version NC_000913.3 GI:556503834
atgcagtacccgattaacgagatgttccagaccctgcaaggtgagggttactttaccggc
gttcccgccatttttattcgtttacagggatgcccggttggctgtgcctggtgcgacacc
aaacacacctgggaaaagcttgaggatcgggaagtctcccttttcagcattctggcgaag
accaaagagagtgataagtggggggctgcgagcagtgaagatttgctggctgtcattggt
cgccagggatacaccgcgcggcatgtggtgattacgggtggtgagccttgcattcatgat
ttgctgccactgactgatctgctcgaaaagaacggttttagctgccagatcgaaaccagt
ggtactcatgaggtacgctgcacaccgaatacctgggttaccgtatcgccaaagctgaac
atgcgcggcggctatgaagtgttgtcacaggcactggagcgagccaacgaaatcaagcat
ccagtggggcgcgtacgcgatattgaagcactggatgaactactggcaacgctgaccgat
gataaaccgcgagtcattgcactgcagccgattagccaaaaggatgatgccacacgtttg
tgcattgaaacctgcattgcgcgtaattggcgtttgtcgatgcaaacacataaatatcta
aatattgcctga
              
                            

Download fasta file
RegulonDB