RegulonDB RegulonDB 10.9: Gene Sequence
gudD gene sequence


Size: 1341        A: 318  T: 309  G: 402  C: 312

Fasta

 

>gudD E. coli K12. Version NC_000913.3 GI:556503834
atgagttctcaatttacgacgcctgttgttactgaaatgcaggttatcccggtggcgggt
catgacagtatgctgatgaatctgagtggtgcacacgcaccgttctttacgcgtaatatt
gtgattatcaaagataattctggtcacactggcgtaggggaaattcccggcggcgagaaa
atccgtaaaacgctggaagatgcgattccgctggtggtaggtaaaacgctgggtgaatac
aaaaacgttctgacgctggtgcgtaatacttttgccgatcgtgatgctggtgggcgcggt
ttgcagacatttgacctacgtaccactattcatgtagttaccgggatagaagcggcaatg
ctggatctgctggggcagcatctgggggtaaacgtggcatcgctgctgggcgatggtcaa
cagcgtagcgaagtcgaaatgctcggttatctgttcttcgtcggtaatcgcaaagccacg
ccgctgccgtatcaaagccagccggatgactcatgcgactggtatcgcctgcgtcatgaa
gaagcgatgacgccggatgcggtggtgcgcctggcggaagcggcatatgaaaaatatggc
ttcaacgatttcaaactgaagggcggtgtactggccggggaagaagaggccgagtctatt
gtggcactggcgcaacgcttcccgcaggcgcgtattacgctcgatcctaacggtgcctgg
tcgctgaacgaagcgattaaaatcggtaaatacctgaaaggttcgctggcttatgcagaa
gatccgtgtggtgcggagcaaggtttctccgggcgtgaagtgatggcagagttccgtcgc
gcgacaggtctaccgactgcaaccaatatgatcgccaccgactggcggcaaatgggccat
acgctctccctgcaatccgttgatatcccgctggcggatccgcatttctggacaatgcaa
ggttcggtacgtgtggcgcaaatgtgccatgaatttggcctgacctggggttcacactct
aacaaccacttcgatatttccctggcgatgtttacccatgttgccgccgctgcaccgggt
aaaattactgctattgatacgcactggatttggcaggaaggcaatcagcgcctgaccaaa
gaaccgtttgagatcaaaggcgggctggtacaggtgccagaaaaaccggggctgggtgta
gaaatcgatatggatcaagtgatgaaagcccatgagctgtatcagaaacacgggcttggc
gcgcgtgacgatgcgatgggaatgcagtatctgattcctggctggacgttcgataacaag
cgcccgtgcatggtgcgttaa
              
                            

Download fasta file
RegulonDB