RegulonDB RegulonDB 10.9: Gene Sequence
gudP gene sequence


Size: 1353        A: 260  T: 386  G: 400  C: 307

Fasta

 

>gudP E. coli K12. Version NC_000913.3 GI:556503834
atgagttctttaagtcaggctgcgagcagtgtggaaaaacgcacaaatgctcgttactgg
atagtggtgatgttgtttatcgtcacatccttcaactacggcgaccgcgctacgctctct
atcgccggttcggaaatggccaaagatatcggccttgatcccgtgggaatgggctatgtg
ttctctgctttctcatgggcttatgttatcgggcagatccctggtggctggttgctggac
cgttttggttcaaaacgcgtctacttctggtcgatctttatctggtcgatgtttaccttg
ctgcaaggcttcgtcgatatctttagtggattcggcattatcgttgccctgtttacgctg
cgcttcctggtcgggcttgctgaagcgccatctttccccggcaacagtcgcattgttgcg
gcctggtttccggcgcaggaaaggggaacggcggtgtcgatttttaactccgctcaatac
ttcgcaacggtgatcttcgcgccgattatgggctggctgacgcatgaagtgggctggtca
cacgtcttcttctttatgggcggtctggggattgtcatcagctttatctggttgaaagtc
atccacgagccaaatcaacatccgggggtaaataagaaagagctggagtacatcgccgcg
ggtggtgcgctgatcaatatggatcagcaaaacaccaaagttaaagtgccgttcagcgtg
aagtgggggcagatcaaacagctgctagggtcacggatgatgatcggcgtttatatcggt
cagtactgtatcaacgccctgacttacttctttattacctggttcccggtttatctggtg
caggcacgcgggatgtcgattctgaaagcgggctttgtggcttccgttccggcggtttgc
ggttttatcggcggtgtgctgggtgggattatttccgactggctgatgcgccgcacggga
tcgctgaacattgcgcgtaaaacaccgatcgtaatgggcatgttgctgtcgatggtgatg
gtgttctgcaactacgtcaacgttgagtggatgatcatcggctttatggcgctggccttc
ttcggtaagggcatcggggcgctgggttgggcagtaatggcagataccgcgccaaaagag
atcagcggtctttccggtggcctgttcaacatgttcggtaacatttctggcatcgtcacg
ccaatcgcaattggttatatcgttggcacgactggctcgtttaatggggcgctgatttat
gttggtgttcatgccttaatcgcggtactgagctacctggtgctggtgggcgatatcaag
cgtatcgagttgaaacctgttgcggggcaataa
              
                            

Download fasta file
RegulonDB