RegulonDB RegulonDB 10.9: Gene Sequence
csdE gene sequence


Size: 444        A: 113  T: 89  G: 133  C: 109

Fasta

 

>csdE E. coli K12. Version NC_000913.3 GI:556503834
atgacaaacccgcaattcgccggacatccgttcggcacaaccgtaaccgcagaaacgtta
cgcaataccttcgcaccgttgacgcaatgggaagataaatatcgccagttgatcatgctg
gggaaacagcttccggcattgccagacgagttaaaagcgcaggctaaagagattgccgga
tgcgaaaaccgcgtctggctgggatatacagtggctgaaaacggcaaaatgcatttcttt
ggcgacagcgaagggcgcattgtgcgcggcctgctggcggtgttgttgactgccgttgag
gggaaaaccgccgccgagttgcaggcacagtcaccactggcattgtttgatgagctggga
ttacgtgcgcagcttagcgcctcacgcagccaggggttaaatgcgttaagcgaggcgatt
atcgctgcgacgaagcaggtttaa
              
                            

Download fasta file
RegulonDB