RegulonDB RegulonDB 10.9: Gene Sequence
tcdA gene sequence


Size: 807        A: 173  T: 193  G: 273  C: 168

Fasta

 

>tcdA E. coli K12. Version NC_000913.3 GI:556503834
atgtctgtggtaattagtgatgcatggcgtcagcgttttggtggcacagcgcgtctgtat
ggtgaaaaagcgttgcaactgtttgctgacgcgcatatttgtgtggttggtatcggtggt
gtcggttcctgggcggcggaagcgctggcgcgcacggggattggcgcaatcacgcttatc
gatatggatgatgtgtgcgtcaccaataccaatcggcaaattcatgccctgcgcgataac
gttgggctggcaaaagcggaagttatggcggagcgtattcgccagattaacccggagtgc
cgtgtaacggtggtggatgatttcgtgacgccggataacgtagcgcagtatatgagcgtg
ggttattcgtacgtgattgatgccattgatagtgtacggcccaaagcggcgctgattgct
tattgtcggcgcaataaaatcccactggtcacaaccggtggcgcgggtgggcagattgat
ccgacgcagattcaggttaccgatctggcgaaaacgattcaggacccgctggcggcgaag
ttgcgcgagcgcctgaaaagcgattttggcgtagtgaaaaacagtaaaggtaagctcggc
gtggattgcgtgttttctactgaagcgctggtgtacccgcagtcagacggtacggtgtgt
gcgatgaaagccacggcagaagggccgaagcggatggattgtgcatctggatttggcgcg
gcaacgatggtgaccgccacctttgggtttgttgcggtttctcatgcgctgaagaagatg
atggcgaaagcggcgcgtcagggttaa
              
                            

Download fasta file
RegulonDB