RegulonDB RegulonDB 10.9: Gene Sequence
rppH gene sequence


Size: 531        A: 148  T: 121  G: 151  C: 111

Fasta

 

>rppH E. coli K12. Version NC_000913.3 GI:556503834
gtgattgatgacgatggctaccgcccaaacgtaggtatcgtgatttgtaatcgccagggg
caggtaatgtgggcccggcgatttggtcagcactcctggcaatttccgcaaggcggaatc
aaccccggagaatccgcagagcaggcgatgtaccgtgaattgtttgaagaagtaggatta
agccgcaaagacgttcgaatccttgcttcaacgcgtaactggttgcgctacaaattaccg
aaacgtttggtgcgttgggacacgaagccggtttgtatcggccaaaaacaaaaatggttt
ctcttgcagctggtgagcggcgatgcagaaatcaatatgcaaaccagcagtacaccagag
tttgacggctggcgatgggtaagttactggtatccggtcagacaggtggtgtcatttaaa
cgtgatgtctaccgtagggtaatgaaagagttcgcgagtgtggtgatgtcactgcaggaa
aatacgccaaaaccacaaaacgcatctgcttatcgacgtaaaagaggttaa
              
                            

Download fasta file
RegulonDB