RegulonDB RegulonDB 10.9: Gene Sequence
ygdQ gene sequence


Size: 714        A: 145  T: 213  G: 184  C: 172

Fasta

 

>ygdQ E. coli K12. Version NC_000913.3 GI:556503834
atgttatttgcatggataaccgatcctaacgcctggcttgcgctcggtacgctgacgctg
ctggagatcgttcttgggatcgacaatattattttcctttctctggtggtggcaaagctt
cccacagcacaacgtgctcatgcgcgccgtctggggttggcgggagccatggttatgcgt
ctggcgctgctggcatcaatcgcctgggttacgcgcctgacaaatccgctttttacaata
ttcagtcaggaaatttctgcccgtgatttgattctgcttctgggtggcttgttccttatc
tggaaagccagcaaggaaatccacgaatccattgaaggtgaagaagaagggctgaaaaca
cgcgtttcatcattcctcggcgctatcgtgcagattatgctgctggatattatctttagc
ctcgactcggtgattacggctgtgggtctgtcagatcacctgtttattatgatggcagcc
gtggtgattgccgtaggcgtgatgatgttcgccgcgcgctcgattggtgattttgtcgaa
cgccatccttcggtaaaaatgctggcgctctctttcctgattctggtgggctttaccctg
attctggaaagtttcgacatccacgtaccgaaaggttacatctacttcgcgatgttcttc
tctattgcggttgaaagcctcaacttgattcgcaacaaaaagaatccgctctga
              
                            

Download fasta file
RegulonDB