RegulonDB RegulonDB 10.8: Gene Sequence
ygdR gene sequence


Size: 219        A: 63  T: 61  G: 58  C: 37

Fasta

 

>ygdR E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaatgggcagtaataatttctgcagtcggactggcgtttgctgtttccgggtgt
tccagtgattacgtcatggcgaccaaagatggccgtatgattttgaccgatggaaaacct
gaaattgatgatgataccgggctggtgagttatcacgatcagcaaggtaacgcgatgcaa
attaaccgtgatgatgtttcgcaaattattgaacgttaa
              
                            

Download fasta file
RegulonDB