RegulonDB RegulonDB 10.9: Gene Sequence
tas gene sequence


Size: 1041        A: 256  T: 219  G: 278  C: 288

Fasta

 

>tas E. coli K12. Version NC_000913.3 GI:556503834
atgcaatatcaccgtataccccacagttcgctggaagtcagcacgctggggcttggcacg
atgacgtttggtgaacagaacagcgaagccgacgcccacgcacaactcgactatgccgtc
gctcagggcattaaccttatcgacgttgccgaaatgtacccagtacctccgcgccccgaa
acgcaagggttaaccgaaacctacgtcggcaactggctggcgaaacatggcagccgcgaa
aagttaattatcgcctccaaagtgagcggaccgtcgcgcaataatgacaagggcatccgc
ccggatcaggcgctggatcggaagaatatccgcgaagcgctgcatgacagcctcaagcgc
ctacagactgattacctcgatctttatcaggtgcactggccgcagcgcccgaccaactgc
ttcggcaaactcggttatagctggacggattctgcgcctgcggtttcgctgctggatacg
ctggacgcactggcagagtaccaacgcgcgggaaaaattcgttatatcggcgtgtcgaac
gaaactgcatttggcgtaatgcgctacctgcatctggcggacaaacacgatctgccgcgt
attgtcaccattcagaacccttacagtctgttaaaccgcagttttgaagtaggtctggca
gaagtcagccagtatgaaggggtcgaactgctggcctattcgtgcctgggtttcggcacg
ctgaccgggaaatatctcaatggtgcaaaacccgctggcgcacgtaatacgctctttagt
cggttcacccgctatagcggtgagcaaacgcaaaaagccgtcgcggcgtatgttgatatc
gccagacgtcatggcctggaccctgctcagatggcgctcgcgtttgtacgccgtcaaccg
tttgttgccagcactctgctgggcgcaaccacgatggatcagctgaaaactaacatcgaa
agtttgcatctggagttaagcgaagacgtattagctgaaattgaagcggtgcatcaggtt
tatacttatccggcaccataa
              
                            

Download fasta file
RegulonDB