RegulonDB RegulonDB 10.9: Gene Sequence
yqeK gene sequence


Size: 426        A: 148  T: 138  G: 75  C: 65

Fasta

 

>yqeK E. coli K12. Version NC_000913.3 GI:556503834
atggacattgaattttcgcagattcatgaaatggtctatatgcatgatattgtaaattcg
gactcgaaaaagaaaccaaggattccgttaaaaaaattccttaatgctgagaatgttctc
acgcaaacaacatcatggacattaaattcaagatatgtgaatgttaattctgtcaataaa
gtcaacgtaaagagtaaagttaaaaacagttatatctcacgatctgtcaatgatgagttt
agtttaacagatgatgaaatcaattcttttaaagaaacgttagtcctttcctctattgat
tcactgagtaaactggttcttaataatcctctttctgtattgtttacatcgactgtacga
aggaataataatcgagctaagatgaatgtcgagttcgactcatggatttgcaccagatgt
tgttga
              
                            

Download fasta file
RegulonDB