RegulonDB RegulonDB 10.9: Gene Sequence
ygeH gene sequence


Size: 1377        A: 496  T: 403  G: 238  C: 240

Fasta

 

>ygeH E. coli K12. Version NC_000913.3 GI:556503834
atggacttagaaaataaattctcatatcattttcttgagggattaacgctcacggaagat
ggaattcttactcaaggaaatgagcaagtttatattccacagaaagagttaggtgtatta
atagtattacttgaatccgctggtcatgttgtactgaaagatatgatcatcgaatcagta
tggaaaaatattattgttagtgacgagtccctgacaagatgtatctattctttgcgctgc
atttttgaaaaaattggctatgatcgttgcatagaaacaatctaccggaaaggttatcgt
ttcagcgggcaggttttcaaaactaaaattaatgaagataatacttcagactattccata
gctatattccctttcactacttcattgaatacactggatccattaatacttaatcaggaa
ttagtgcaaatcatttcaaataaaaaaatcgatggtctctatacctatccgatggctgcg
acaaatttttgtaatgatcacatatctcaaaattcattcttgagcagattcaagccagat
tatttcgttacaggaagaataaaccagaataatgcagtgaacactttatacattgagttg
atcgacgctaaaaaccttttcctcatcgccagtaatcatctccctgttgatgaactacat
aatacatcacaatttattatagataatatccttcaaacggtacataaaccagaacgatct
gtaagattagctaagcaggaccaaggatataagaatcattatttatcagatgaaatgtta
gccggaaagaaagaactttacgacttcacccctgaaagcatttacagggccatgactata
tttgatagattacaaaataaaagtgatatacagacgctaaaaacagaatgttattgcctt
ctagcggaatgccatatgtctttggcacttcatggaaaaagtgaacttgaacttgctgct
caaaaagcattagagcttttagattatgtatcagacataaccactgtcgatggaaaaatt
ttagctattatgggactgataactggtctgtctggacaagcaaaagtatctcatatctta
tttgaacaggctaagatacactcaactgatatagcctctctctactactatagggcacta
gtccactttcataatgaaaaaattgaagaggcaaggatttgtatagacaaatcactacaa
ctcgaacccagaagacgaaaagcagttgtgataaaagaatgtgtagatatgtatgtgcct
aacccgctcaaaaacaacattaaactctactataaagaaactgagagtgaaagccatcga
gttataattgacaacattttgaaattaaagcagctgacgagaatttgtatgcgataa
              
                            

Download fasta file
RegulonDB