RegulonDB RegulonDB 10.9: Gene Sequence
ygeI gene sequence


Size: 219        A: 81  T: 64  G: 35  C: 39

Fasta

 

>ygeI E. coli K12. Version NC_000913.3 GI:556503834
atgactaatccaatcggtatcaataatttatctcaaagttcaaatatagcgaatgcaacg
ggtgatgaagtcgtatcattagataaacacatcaacaccagtgctactgatacagatcaa
atacaagcatttatagtttcaacatggatggcgccttttcaaaatgatatgtattcagaa
gataatcctatctcaccttactataaaattgagtggtag
              
                            

Download fasta file
RegulonDB