RegulonDB RegulonDB 10.9: Gene Sequence
ygeO gene sequence


Size: 399        A: 128  T: 129  G: 70  C: 72

Fasta

 

>ygeO E. coli K12. Version NC_000913.3 GI:556503834
ataaacaattggaatttacttccattgatctgtttactcagtggttgtcacttttatcga
gaaaggtttgcagaacgcgggtttttttataaggttcctgatgtactaagggattattta
tcagctataccgctggaaataaatgaaaaggcacgatacaaacccggcatcgctaactat
cacaatatcatcacatgtggtttttcaacgttgttaccctatataaggcaacaaccattg
gcaatgcagcaacgatttaatttattatttcctgattttgttgaccacatacaatcgccg
ttaccacttgcatcaacacttttagagagaattacattttatgcgaaaaaaaatagagat
gagcttgataaaatctcctgcaaatggtgttgtgattaa
              
                            

Download fasta file
RegulonDB