RegulonDB RegulonDB 10.9: Gene Sequence
ygfK gene sequence


Size: 3099        A: 777  T: 704  G: 775  C: 843

Fasta

 

>ygfK E. coli K12. Version NC_000913.3 GI:556503834
atgggggatattatgcgtcccattccgtttgaggaacttttgacgcgcatatttgatgaa
taccaacaacaacgctcaatctttggtattcccgagcaacagttttactcacctgtaaaa
ggtaaaactgttagcgtcttcggtgaaacctgtgccactcccgtcggccctgccgctggc
ccgcacacgcagctcgcgcaaaatattgtcacttcctggctgactggcggacgcttcatc
gaactaaaaaccgtccaaattcttgaccgcctggagctggaaaagccctgtatcgatgcc
gaagacgagtgctttaacaccgaatggtctaccgagtttaccctgcttaaagcctgggat
gaatacctcaaagcctggtttgccctgcaccttctcgaagcgatgttccagccttctgat
tccggtaaatcgttcatctttaatatgagcgtcggttacaacctcgaaggtattaagcaa
ccgccgatgcaacagttcatcgacaatatgatggacgcatctgaccatccgaaattcgct
caatatcgcgatacgctgaataaattactccaggatgacgcatttttagctcgccacgga
ttgcaggaaaaacgcgaaagcttgcaagccttacccgctcgcatccccaccagtatggtg
catggcgtcaccctctccaccatgcacggctgtcctccgcatgaaatcgaagccatttgc
cgctacatgctggaagaaaaagggctcaacacctttgtgaaacttaacccgaccttactg
gggtacgcgcgtgttcgtgagatcctcgatgtctgcggtttcggttacataggcttaaaa
gaagagtcatttgatcacgacctcaagctgacgcaagcactggaaatgctggaacgcctg
atggcactggcaaaagaaaaatcactcggctttggcgtaaaactgactaacactctcggc
accatcaacaataaaggcgcactgcctggtgaagagatgtatatgtcaggccgtgcgctg
ttcccgctctccatcaatgttgcagcagttctctctcgcgcctttgacggcaaactgccc
atttcttattccggtggtgccagtcagctgactatccgcgatatttttgatacaggtatt
cgccctattactatggcaaccgacctgctgaaacctggcggctatctgcgcttaagtgcc
tgcatgcgcgagctggaaggctccgacgcctggggacttgaccatgttgacgtcgaacga
ctgaacagactggcagcagatgcgttaaccatggaatacacccagaaacactggaagcca
gaagagcgtattgaagtggcagaagacctgccgctgaccgactgctacgttgccccctgt
gttactgcctgcgctatcaagcaagatattccggaatacatccgtctgcttggcgaacac
cgctatgccgacgcgctggaactcatctaccaacgcaacgctctgcccgccattaccggt
catatttgcgatcaccagtgccaatacaactgtacccgcctggattacgacagtgcgctg
aatatccgcgaactgaaaaaagtcgcgctggaaaaaggttgggatgaatataagcaacgc
tggcacaaaccagccggttctggttcacgccatccggttgccgtgattggtgcaggtccg
gcgggtctggcagcaggttacttccttgccagagcgggccatccggttacgctgtttgaa
cgcgaagccaatgcgggcggcgtggtgaaaaatatcattcctcagttccgtattcctgca
gagttaattcagcacgatatcgattttgttgccgctcacggcgtgaaatttgagtatggc
tgctcacccgatttaaccattgagcagttaaaaaatcagggcttccactatgttctgatt
gccaccggcactgataaaaatagcggtgtgaaactggcgggcgacaaccaaaatgtctgg
aaatcactccccttcctgcgtgaatacaacaagggtacagcgctcaagctgggcaaacat
gtggtcgttgtcggggcgggtaacaccgcaatggactgcgctcgtgcggcgttacgcgtt
ccaggcgtagaaaaagcaacgatcgtttaccgtcgttcactacaagagatgcccgcatgg
cgcgaagagtatgaagaagcgttgcacgacggcgtagagttccgtttcctgaataatccg
gaacgtttcgatgctgatggcaccttaaccttgcgcgttatgtcgcttggcgaaccggat
gagaaaggtcgtcgtcgtccggttgaaaccaatgaaacagtaacactgcttgtagacagc
ctgatcaccgccattggtgaacagcaggatactgaagccctgaatgcgatgggcgtgccg
ctggacaaaaacggctggccagacgtcgaccataatggcgaaactcgtctgactgacgtc
tttatgatcggcgacgtacagcgcggaccatcctccattgtcgctgctgtcggaaccgcg
cgtcgggcgaccgatgccatccttagtcgggaaaatatccgttcccaccagaacgataaa
tactggaacaacgtcaatccagcggaaatctatcaacgtaaaggcgatatctctatcacg
ctggtgaacagtgacgatcgtgacgcgtttgtcgcccaggaagccgctcgctgcctcgaa
tgtaactacgtttgcagcaagtgtgtggatgtctgcccgaaccgcgccaacgtctccatt
gcggtcccaggcttccagaaccgtttccagacgctgcacctcgacgcttactgtaacgaa
tgcggcaactgcgctcagttctgtccgtggaacggtaaaccgtacaaagacaaaatcacc
gtcttcagcctggcgcaagactttgataacagcagcaacccaggcttccttgtggaagat
tgccgggtacgagtacgtctgaataaccaaagctgggtgttaaacatcgacagcaaaggt
cagtttaacaacgtaccaccggagctgaacgatatgtgccgcatcatcagccatgtccac
cagcatcatcattatctgctgggccgcgtggaggtgtaa
              
                            

Download fasta file
RegulonDB